| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.222731 |
| Chromosome: | chromosome 1 |
| Location: | 5648769 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g040200 | WNK2 | (1 of 5) K08867 - WNK lysine deficient protein kinase [EC:2.7.11.1] (WNK, PRKWNK); WNK protein kinase | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATTATCAAAGATGGAGGGCGAGGGGCTGC |
| Internal bar code: | CCAGATATAACCAATACCGAAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 839 |
| LEAP-Seq percent confirming: | 99.6552 |
| LEAP-Seq n confirming: | 4335 |
| LEAP-Seq n nonconfirming: | 15 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGAGCACACGAATTTCAGC |
| Suggested primer 2: | GCTCTAAAAGCAGGGTGTCG |