| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.222803 |
| Chromosome: | chromosome 14 |
| Location: | 3738391 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g632100 | (1 of 3) IPR006502//IPR011705 - Protein of unknown function PDDEXK-like // BTB/Kelch-associated | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGGCGCAGAAAGTTGTGGGCGAGCCGCTG |
| Internal bar code: | GATCCGCTGGAACACGTCGGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 488 |
| LEAP-Seq percent confirming: | 94.6921 |
| LEAP-Seq n confirming: | 1338 |
| LEAP-Seq n nonconfirming: | 75 |
| LEAP-Seq n unique pos: | 31 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGTCTTCAACGCCAAAAGC |
| Suggested primer 2: | ACAAGCCCTCTTCACCCTCT |