| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.222821 |
| Chromosome: | chromosome 3 |
| Location: | 3931872 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g171461 | HEMN1 | Coproporphyrinogen III oxidase; (1 of 1) 1.3.99.22 - Coproporphyrinogen dehydrogenase / Oxygen-independent coproporphyrinogen-III oxidase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTGGGCGGCTGGGCGCAGTGCAGTACGCG |
| Internal bar code: | CACGGATATCGCGCGCCGACAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 595 |
| LEAP-Seq percent confirming: | 98.3906 |
| LEAP-Seq n confirming: | 1345 |
| LEAP-Seq n nonconfirming: | 22 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTGTCCGTTTGGGTAGACT |
| Suggested primer 2: | ACACCTGGAGGGTGTGGTAG |