| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.222856 |
| Chromosome: | chromosome 8 |
| Location: | 36531 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g358400 | (1 of 4) PF05653 - Magnesium transporter NIPA (Mg_trans_NIPA) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGTTCTGACTACCTCGCATCAAAGCCATCA |
| Internal bar code: | TAGGTTGCCTAAGGGTAGGTAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 486 |
| LEAP-Seq percent confirming: | 98.6141 |
| LEAP-Seq n confirming: | 925 |
| LEAP-Seq n nonconfirming: | 13 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTCACTACGCCCAGATGTT |
| Suggested primer 2: | GGCTCCGTCTCCGTAATGTA |