Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.222870 |
Chromosome: | chromosome 10 |
Location: | 4250046 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g450350 | Hspb11,FAP232,IFT25 | Intraflagellar Transport Protein 25; (1 of 1) K19369 - heat shock protein beta-11 (HSPB11) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGGTGCGGTGCATGAGCGCGGCAACCTGT |
Internal bar code: | GTTAGCTCGTCCCGGCCCAATT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 728 |
LEAP-Seq percent confirming: | 99.477 |
LEAP-Seq n confirming: | 5896 |
LEAP-Seq n nonconfirming: | 31 |
LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAATTACGGGGTCCAATGAC |
Suggested primer 2: | GACACAGTAGGGGCCACATT |