Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.222896 |
Chromosome: | chromosome 17 |
Location: | 3090244 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g721000 | ABCA5 | (1 of 2) PTHR19229//PTHR19229:SF127 - ATP-BINDING CASSETTE TRANSPORTER SUBFAMILY A ABCA // SUBFAMILY NOT NAMED; ABC transporter 5 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAGGCGCGCGGTGTGATACCAAAATGATG |
Internal bar code: | AAGTGGGAAAGAACGGTGTTGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 595 |
LEAP-Seq percent confirming: | 90.7489 |
LEAP-Seq n confirming: | 1442 |
LEAP-Seq n nonconfirming: | 147 |
LEAP-Seq n unique pos: | 40 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGGTGTAAGCCTGGTTGTCA |
Suggested primer 2: | CCAGTCTGCAGTCACTTCCA |