| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.222947 |
| Chromosome: | chromosome 1 |
| Location: | 6357556 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g046652 | (1 of 3) K01866 - tyrosyl-tRNA synthetase (YARS, tyrS); Putative tyrosyl tRNA synthase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGGCGCCACAATCGCCTAAGAAGTACCGG |
| Internal bar code: | TTGCACCTCGGCGAAGGGGTCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1145 |
| LEAP-Seq percent confirming: | 99.0371 |
| LEAP-Seq n confirming: | 720 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACGGTGTGTTGTCATCCTG |
| Suggested primer 2: | CGCTACCCAGAACCAATCAT |