Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.222963 |
Chromosome: | chromosome 16 |
Location: | 4820005 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g686200 | TSPSP2,TPT1,TPS3,TSSP2 | (1 of 2) K16055 - trehalose 6-phosphate synthase/phosphatase (TPS); Triose-phosphTrehalose-6-phosphate synthase/phosphataseate transporter, class II | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGATATGCCGATCTAACTTGGCGGCAGCAG |
Internal bar code: | GGTCGCTGGGCAGCCAGGAGCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 170 |
LEAP-Seq percent confirming: | 98.7654 |
LEAP-Seq n confirming: | 80 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATGCTTCCGGTCATTCAGAG |
Suggested primer 2: | CAAGCTGAGGGCAGTACACA |