| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.223017 |
| Chromosome: | chromosome 8 |
| Location: | 2027254 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g368300 | HEL43 | Putative RNA helicase; (1 of 4) IPR001650//IPR006935//IPR014001//IPR027417 - Helicase, C-terminal // Helicase/UvrB, N-terminal // Helicase superfamily 1/2, ATP-binding domain // P-loop containing nucleoside triphosphate hydrolase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGCCAGGTGCGTGCCTTGTGCTGTTGTGC |
| Internal bar code: | GCATTCGGCGTACCCCGGCGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 723 |
| LEAP-Seq percent confirming: | 98.9404 |
| LEAP-Seq n confirming: | 3268 |
| LEAP-Seq n nonconfirming: | 35 |
| LEAP-Seq n unique pos: | 38 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCTACTGTCTCAACCCCAA |
| Suggested primer 2: | GGCGTCACTCCTATCTGCTC |