Insertion junction: LMJ.RY0402.223021_2

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.223021
Chromosome:chromosome_8
Location:4151436
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre08.g379900 sense CDS

Insertion site details

Flanking sequence (orientation from cassette outwards):TTGCTTGGCGGCGGCGGGACAGGCGGCGGG
Internal bar code:AGTGGGGGGGCTGGGGTGTTAG

Confirmation - LEAP-Seq

LEAP-Seq distance:544
LEAP-Seq percent confirming:83.038
LEAP-Seq n confirming:328
LEAP-Seq n nonconfirming:67
LEAP-Seq n unique pos:8

Suggested primers for confirmation by PCR

Suggested primer 1:TTGTAACGACAGCTTGCGAC
Suggested primer 2:TTTTCCTGTGCTTTCCTGCT