| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.223084 |
| Chromosome: | chromosome 7 |
| Location: | 3048655 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g333535 | (1 of 1) K04856 - voltage-dependent calcium channel T type alpha-1I (CACNA1I) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGAAAGCATTTGCAAACCACAATGAGAAT |
| Internal bar code: | GTCTCTTCCAGCCTTTTTGGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1033 |
| LEAP-Seq percent confirming: | 99.718 |
| LEAP-Seq n confirming: | 6718 |
| LEAP-Seq n nonconfirming: | 19 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACCACAAGTGTCCACGGAA |
| Suggested primer 2: | GGTGGGCAGTGGAGAAGATA |