Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.223137 |
Chromosome: | chromosome 7 |
Location: | 1735601 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g325715 | (1 of 29) PF13637 - Ankyrin repeats (many copies) (Ank_4) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTGGCTCCCTGATCGTCTTGCCAACACTC |
Internal bar code: | GCGGGCAGAGAAAACTCGGTGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 582 |
LEAP-Seq percent confirming: | 99.5468 |
LEAP-Seq n confirming: | 4832 |
LEAP-Seq n nonconfirming: | 22 |
LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTGGGGAAGGTCTTTTAGGC |
Suggested primer 2: | TCCTTGTCCTCTAGCTCCGA |