Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.223202 |
Chromosome: | scaffold 19 |
Location: | 200088 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre19.g751247 | (1 of 1) K16742 - ADP-ribosylation factor-like protein 2-binding protein (ARL2BP, BART) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGGTCCACGCGGACTCACCACCAGCTCGC |
Internal bar code: | TGTCTGACATCTTAACCAACCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 623 |
LEAP-Seq percent confirming: | 98.3616 |
LEAP-Seq n confirming: | 1621 |
LEAP-Seq n nonconfirming: | 27 |
LEAP-Seq n unique pos: | 27 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTAAGAGCAACGGGAGCAAG |
Suggested primer 2: | TGTATAATCCCGCTCAAGCC |