Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.223245 |
Chromosome: | chromosome 6 |
Location: | 2714447 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g270500 | (1 of 1) PF00759//PF03067 - Glycosyl hydrolase family 9 (Glyco_hydro_9) // Chitin binding domain (Chitin_bind_3) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCACCGACAACGCCAACTGCGCCACCTGCT |
Internal bar code: | GTGTGGCTTGGTGATTAATTTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 911 |
LEAP-Seq percent confirming: | 99.6711 |
LEAP-Seq n confirming: | 303 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTTCGTATGTGCCTGTGTGG |
Suggested primer 2: | AGGTGGCCATCGACTACAAC |