| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.223313 |
| Chromosome: | chromosome 9 |
| Location: | 6937398 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g410450 | ROC15,ROC74 | Rhythm Of Chloroplast 15; (1 of 4) IPR001005//IPR006447//IPR009057//IPR017930 - SANT/Myb domain // Myb domain, plants // Homeodomain-like // Myb domain | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTCGTTCAACTAGCCCACAGTCCCATTTA |
| Internal bar code: | TTGGGCGGTGGACTCGTCCCGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 724 |
| LEAP-Seq percent confirming: | 98.3731 |
| LEAP-Seq n confirming: | 907 |
| LEAP-Seq n nonconfirming: | 15 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGAGGGAAGGTGTGAGCAG |
| Suggested primer 2: | GATGTGACATTGCCGATGAG |