| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.223361 |
| Chromosome: | chromosome 8 |
| Location: | 3904029 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g378200 | PPO1 | (1 of 1) 5.1.99.6 - NAD(P)H-hydrate epimerase / NAD(P)HX epimerase; Pyridoxamine 5'-phosphate oxidase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAAAAAGACGAAGCCCGCCCATGTGTGTGT |
| Internal bar code: | ACCAGGGGATCAGGCGGACGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 331 |
| LEAP-Seq percent confirming: | 46.3602 |
| LEAP-Seq n confirming: | 13291 |
| LEAP-Seq n nonconfirming: | 15378 |
| LEAP-Seq n unique pos: | 109 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGTCCAAACAACAGCCACC |
| Suggested primer 2: | GCACCTGTACCACTTCGGAT |