| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.223417 |
| Chromosome: | chromosome 4 |
| Location: | 3018849 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g225050 | (1 of 3) PF16166 - Chloroplast import apparatus Tic20-like (TIC20) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGGAATGGAGCACCGGGCATTTGGGCTTG |
| Internal bar code: | GTGGGCTAGGACGGTCGCAGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 615 |
| LEAP-Seq percent confirming: | 90.5754 |
| LEAP-Seq n confirming: | 913 |
| LEAP-Seq n nonconfirming: | 95 |
| LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTACCTCGACTTAGCAGCGG |
| Suggested primer 2: | AAAATGACGTCCCTACACGC |