| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.223417 |
| Chromosome: | chromosome 6 |
| Location: | 5230422 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g282150 | CNX1G,CNX1C | (1 of 2) 2.7.7.75 - Molybdopterin adenylyltransferase; Molybdenum cofactor biosynthesis protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTGTTTCCCCGACACGCTCTCTGCACGGC |
| Internal bar code: | ACTGGATAGCGATAGGGGGGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 403 |
| LEAP-Seq percent confirming: | 99.5392 |
| LEAP-Seq n confirming: | 432 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCAAGTCCATCCCCTACTGC |
| Suggested primer 2: | TAGATGGGGTCACCCAAGAG |