| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.223449 |
| Chromosome: | chromosome 17 |
| Location: | 6209413 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g742000 | MOT8 | Predicted protein; (1 of 3) 3.1.3.66 - Phosphatidylinositol-3,4-bisphosphate 4-phosphatase / Phosphoinositide 4-phosphatase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTACCGTATGTGCACGGTCCGCATTACAGC |
| Internal bar code: | GGTGTACTCATTTTGATTGTCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1289 |
| LEAP-Seq percent confirming: | 97.8872 |
| LEAP-Seq n confirming: | 4772 |
| LEAP-Seq n nonconfirming: | 103 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCTGGTGTTGTTGGTGACA |
| Suggested primer 2: | GGCTCCTGTCCTCACTCAAG |