| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.223507 |
| Chromosome: | chromosome 14 |
| Location: | 1390448 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g617300 | PSL3 | (1 of 1) PTHR12174//PTHR12174:SF42 - SIGNAL PEPTIDE PEPTIDASE // SUBFAMILY NOT NAMED; Signal peptide peptidase-like protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCTGGCAAGGCATGCACAACCATAAACTT |
| Internal bar code: | AGTTGGTACGTCGAGTTTATCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 292 |
| LEAP-Seq percent confirming: | 98.3593 |
| LEAP-Seq n confirming: | 1199 |
| LEAP-Seq n nonconfirming: | 20 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTGTGGGTTGAAGTCAGGT |
| Suggested primer 2: | CTCTTCCTCCATTTCTCCCC |