| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.223532 |
| Chromosome: | chromosome 7 |
| Location: | 1720736 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g325712 | (1 of 1) PTHR10792:SF8 - RIBOSOME BIOGENESIS PROTEIN RLP24-RELATED | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCGACACCCTCCCTACCACCTCTATGAGC |
| Internal bar code: | GAGAGCCGCGATCCCTGGATTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 675 |
| LEAP-Seq percent confirming: | 99.5158 |
| LEAP-Seq n confirming: | 11920 |
| LEAP-Seq n nonconfirming: | 58 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGGAGAAGCTCAAGGAGCC |
| Suggested primer 2: | CTGTAGAGGAGAAGTGGCCG |