| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.223554 |
| Chromosome: | chromosome 5 |
| Location: | 1425865 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g244150 | (1 of 1) IPR002073//IPR020683 - 3'5'-cyclic nucleotide phosphodiesterase, catalytic domain // Ankyrin repeat-containing domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGAGCAGGGCACGTTCAAGGCCGCAGGCGA |
| Internal bar code: | ACCACCGCACAGCTGCCATGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 544 |
| LEAP-Seq percent confirming: | 64.6766 |
| LEAP-Seq n confirming: | 650 |
| LEAP-Seq n nonconfirming: | 355 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCTCTCTCTCCACGTTGTC |
| Suggested primer 2: | TGCAAATGGAAAGTGGTTCA |