| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.223561 |
| Chromosome: | chromosome 3 |
| Location: | 4547226 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g176700 | mS29,MRPS29,CPL4 | Mitochondrial ribosomal protein S29; (1 of 1) K17408 - small subunit ribosomal protein S29 (DAP3, MRPS29) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGCATGCACAAACAAACTCTCCATTTTGT |
| Internal bar code: | CGGCTTTCCTCTGTAGAGTCGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 340 |
| LEAP-Seq percent confirming: | 89.8246 |
| LEAP-Seq n confirming: | 1280 |
| LEAP-Seq n nonconfirming: | 145 |
| LEAP-Seq n unique pos: | 28 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCCTTGTCAACAGCACTTCG |
| Suggested primer 2: | CTCTCACTTACCCACCCCAA |