Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.223565 |
Chromosome: | chromosome 6 |
Location: | 7352236 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g299050 | DGTT3 | (1 of 4) K14457 - 2-acylglycerol O-acyltransferase 2 (MOGAT2, MGAT2); Diacylglycerol O-acyltransferase | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATGAAGCCTTGGGACGGGGAACGTCCAAA |
Internal bar code: | ATCACTTATGATCATGCTAGCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 625 |
LEAP-Seq percent confirming: | 99.3205 |
LEAP-Seq n confirming: | 4970 |
LEAP-Seq n nonconfirming: | 34 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCTCGCCTTCTCACGTAAAC |
Suggested primer 2: | GTGACCCCAGTCAGTCCAGT |