| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.223755 |
| Chromosome: | chromosome 1 |
| Location: | 3953481 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g025750 | (1 of 1) PF01551 - Peptidase family M23 (Peptidase_M23) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTATTCCAGTTGCACGGGTACGACGATAC |
| Internal bar code: | GCAAGGTGTTGGGTCCGATTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 397 |
| LEAP-Seq percent confirming: | 98.8475 |
| LEAP-Seq n confirming: | 4460 |
| LEAP-Seq n nonconfirming: | 52 |
| LEAP-Seq n unique pos: | 47 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACTTCTACGCACACCAGCA |
| Suggested primer 2: | GATTAGAGGGAGGGAGCCAC |