Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.223798 |
Chromosome: | chromosome 16 |
Location: | 4760775 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g686650 | (1 of 1) PTHR31057//PTHR31057:SF0 - FAMILY NOT NAMED // E3 UFM1-PROTEIN LIGASE 1 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCACACCACCCGCCACCTGCCCCCGGCCCT |
Internal bar code: | CGGGTGTAGCAGACTCTGGGCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 142 |
LEAP-Seq percent confirming: | 12.2807 |
LEAP-Seq n confirming: | 7 |
LEAP-Seq n nonconfirming: | 50 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGAGCTCCTGCATACCCTGA |
Suggested primer 2: | CTCCTCAATGAGTGTGGCAA |