| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.223808 |
| Chromosome: | chromosome 6 |
| Location: | 6509134 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g293150 | PGM12 | (1 of 2) PTHR23029:SF12 - PHOSPHOMUTASE PMU1-RELATED; Phosphoglycerate mutase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCAAGATCAAAATAATTTCTTCCGCCAGA |
| Internal bar code: | GACGGTCGGACGCGGCGTGTGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 414 |
| LEAP-Seq percent confirming: | 97.8142 |
| LEAP-Seq n confirming: | 179 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGTGGCGACTTTTAGCCTGA |
| Suggested primer 2: | GGCACATGATTTGTTTGTGC |