| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.223815 |
| Chromosome: | chromosome 9 |
| Location: | 2087292 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g393900 | GCH2 | Putative GTP cyclohydrolase; (1 of 2) 3.5.4.25 - GTP cyclohydrolase II | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGGTGAAGTGTGTCGCCAAGTGCGCCGTT |
| Internal bar code: | GGCGCCTCGAATTGGGCAGTAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 757 |
| LEAP-Seq percent confirming: | 99.0881 |
| LEAP-Seq n confirming: | 1304 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 30 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGTACCGGAGGTAGCAGCA |
| Suggested primer 2: | GGAGCTCCGCTGCTATACAC |