Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.223925 |
Chromosome: | chromosome 12 |
Location: | 7485090 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g556000 | ECP88 | 88 kDa extracellular polypeptide; (1 of 5) PF06742//PF06863 - Protein of unknown function (DUF1214) (DUF1214) // Protein of unknown function (DUF1254) (DUF1254) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATCCGACGCTTCCAGGGTCCCACCGCCTG |
Internal bar code: | GCGTCAGGTTTGGCTGTGCGTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 690 |
LEAP-Seq percent confirming: | 99.1039 |
LEAP-Seq n confirming: | 2433 |
LEAP-Seq n nonconfirming: | 22 |
LEAP-Seq n unique pos: | 40 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCCTGGCTGACACCTACATT |
Suggested primer 2: | AAGTGATAGCAAGGAGCCGA |