| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.223964 |
| Chromosome: | chromosome 12 |
| Location: | 8199742 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g550750 | SDHAF2,EMI5 | (1 of 2) PF03937 - Flavinator of succinate dehydrogenase (Sdh5); Succinate dehydrogenase assembly factor 2 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGCGTGGCATGACGGCGCGTTTACGTGGA |
| Internal bar code: | GCGACGCTTGAGAGTTCTCCCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1130 |
| LEAP-Seq percent confirming: | 99.0757 |
| LEAP-Seq n confirming: | 6967 |
| LEAP-Seq n nonconfirming: | 65 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTAGGTTCTGCCACCGATGT |
| Suggested primer 2: | TGCAAACCACCTCACAACAT |