Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.223964 |
Chromosome: | chromosome 12 |
Location: | 8199742 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g550750 | SDHAF2,EMI5 | (1 of 2) PF03937 - Flavinator of succinate dehydrogenase (Sdh5); Succinate dehydrogenase assembly factor 2 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGCGTGGCATGACGGCGCGTTTACGTGGA |
Internal bar code: | GCGACGCTTGAGAGTTCTCCCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1130 |
LEAP-Seq percent confirming: | 99.0757 |
LEAP-Seq n confirming: | 6967 |
LEAP-Seq n nonconfirming: | 65 |
LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTAGGTTCTGCCACCGATGT |
Suggested primer 2: | TGCAAACCACCTCACAACAT |