| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.224003 |
| Chromosome: | chromosome 3 |
| Location: | 3809688 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g170400 | (1 of 1) PF12579 - Protein of unknown function (DUF3755) (DUF3755) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACTCCACACACACCCGCAGTCCCCTCCCG |
| Internal bar code: | CGGTTCGCACTCAGCTCGATTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 688 |
| LEAP-Seq percent confirming: | 98.9792 |
| LEAP-Seq n confirming: | 51485 |
| LEAP-Seq n nonconfirming: | 531 |
| LEAP-Seq n unique pos: | 330 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTTGTGAGCATGCAGGAAAG |
| Suggested primer 2: | GAAAGCAGACGCAGAAAACC |