| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.224166 |
| Chromosome: | chromosome 4 |
| Location: | 1454991 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g214150 | THI4 | Thiazole biosynthetic enzyme; (1 of 1) K03146 - thiamine thiazole synthase (THI4, THI1) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGAGAGAAGATACACGTGCCTCACCACTCT |
| Internal bar code: | TGCCCCGGTTCATCGGGGATTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 656 |
| LEAP-Seq percent confirming: | 99.8183 |
| LEAP-Seq n confirming: | 1099 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 38 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCAGAACCTACTGGGCTGC |
| Suggested primer 2: | CATGGTTGGAAAGTCCGAGT |