Insertion junction: LMJ.RY0402.224245_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.224245
Chromosome:chromosome_10
Location:3836347
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre10.g447300 antisense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):GTTTGCGCAACGCCATACAACATTTTGTGT
Internal bar code:ACTAACACTGAGGCCGACAGGG

Confirmation - LEAP-Seq

LEAP-Seq distance:570
LEAP-Seq percent confirming:100.0
LEAP-Seq n confirming:117
LEAP-Seq n nonconfirming:0
LEAP-Seq n unique pos:7

Suggested primers for confirmation by PCR

Suggested primer 1:TTTTCATCATCAGGGCACAG
Suggested primer 2:CCCTACCTGTGATGTGCCTT