Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.224259 |
Chromosome: | chromosome 1 |
Location: | 1886590 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g010250 | PPP2 | (1 of 3) PTHR12320//PTHR12320:SF15 - PROTEIN PHOSPHATASE 2C // SUBFAMILY NOT NAMED; Phosphoprotein phosphatase 2C-related | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTACAACGTCCCCGCCGCCGCACCTGCAGC |
Internal bar code: | GTCCAAGACTTGTGTAACGAAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 131 |
LEAP-Seq percent confirming: | 27.9373 |
LEAP-Seq n confirming: | 107 |
LEAP-Seq n nonconfirming: | 276 |
LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTGACCACCAATCAGCCTTT |
Suggested primer 2: | GTGTTTTGTACCCGCCAATC |