Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.224270 |
Chromosome: | chromosome 1 |
Location: | 5789210 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g041351 | (1 of 1) PTHR15967:SF0 - E2F-ASSOCIATED PHOSPHOPROTEIN | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGATGGGGGCTTCCGCATCAAAACTGACA |
Internal bar code: | GGGGGAGTGGGGCGCCAGCATT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 435 |
LEAP-Seq percent confirming: | 92.0442 |
LEAP-Seq n confirming: | 833 |
LEAP-Seq n nonconfirming: | 72 |
LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTTCTGACTCAGGCTTCGGT |
Suggested primer 2: | TCACATCTCGGCTCACAGAC |