| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.224274 |
| Chromosome: | chromosome 9 |
| Location: | 1445187 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g398400 | TRP5 | Transient receptor potential ion channel protein; (1 of 46) PF00520 - Ion transport protein (Ion_trans) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGTCGCAGTGGCTGCATTTCATGACGGTGC |
| Internal bar code: | CCGGCGAAACTACGGCCAGAGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 595 |
| LEAP-Seq percent confirming: | 99.0248 |
| LEAP-Seq n confirming: | 1320 |
| LEAP-Seq n nonconfirming: | 13 |
| LEAP-Seq n unique pos: | 27 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATCTTAGCCGCACTGTTCA |
| Suggested primer 2: | TGCACATCTAGCCACCTCAG |