| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.224310 |
| Chromosome: | chromosome 2 |
| Location: | 107745 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g074000 | POC18 | Proteome of centriole protein 18; (1 of 1) PTHR19853//PTHR19853:SF1 - WD REPEAT CONTAINING PROTEIN 3 WDR3 // TBC1 DOMAIN FAMILY MEMBER 31 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTACAGCCTTACCCGCATCCAGTCTCCGCG |
| Internal bar code: | CCAGTTGCGGTCCAGCTTGGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 240 |
| LEAP-Seq percent confirming: | 88.5662 |
| LEAP-Seq n confirming: | 976 |
| LEAP-Seq n nonconfirming: | 126 |
| LEAP-Seq n unique pos: | 49 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTACTGCATACATCGTGGCG |
| Suggested primer 2: | TGCACTACCCCAGGGACTAC |