| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.224371 |
| Chromosome: | chromosome 10 |
| Location: | 6348537 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g465450 | (1 of 2) 2.8.2.20 - Protein-tyrosine sulfotransferase / Tyrosylprotein sulfotransferase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCACCTGCCGCCCGGCCGCCTGCTCACAC |
| Internal bar code: | TCTGCCTTGGGATGCGATACTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 127 |
| LEAP-Seq percent confirming: | 99.2239 |
| LEAP-Seq n confirming: | 16877 |
| LEAP-Seq n nonconfirming: | 132 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AATACGTCAGCAGGTCCCAC |
| Suggested primer 2: | CCAACCGCTACTGAGCTTTC |