| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.224385 |
| Chromosome: | chromosome 14 |
| Location: | 1819305 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g620150 | (1 of 1) PTHR10120//PTHR10120:SF21 - CAAX PRENYL PROTEASE 1 // SUBFAMILY NOT NAMED | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCACACGAACTGTAAGACAAAACTGTTTG |
| Internal bar code: | GACAGCGTCGAAGGAGTGAGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 325 |
| LEAP-Seq percent confirming: | 79.7697 |
| LEAP-Seq n confirming: | 485 |
| LEAP-Seq n nonconfirming: | 123 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGGACACACATACGAACAC |
| Suggested primer 2: | GGTCTACAACATGGTCCGCT |