| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.224468 |
| Chromosome: | chromosome 1 |
| Location: | 5610628 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g039850 | CPK5,CGL48 | (1 of 1) PF00294//PF03641 - pfkB family carbohydrate kinase (PfkB) // Possible lysine decarboxylase (Lysine_decarbox); conserved protein related to lysine decarboxylase domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACTCTTTCCCTCCGCCGGCTCCCGCGCCC |
| Internal bar code: | ACACTGTAGAGATTTTTATAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1298 |
| LEAP-Seq percent confirming: | 97.8118 |
| LEAP-Seq n confirming: | 447 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGCGAACCTACACAGACCC |
| Suggested primer 2: | TGAAATTGGGTACGAGGGAG |