Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.224479 |
Chromosome: | chromosome 16 |
Location: | 1500118 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g653000 | (1 of 1) K18404 - tudor domain-containing protein 3 (TDRD3) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGGAGCATCCCCACCCCCTCAGGCCACTG |
Internal bar code: | CCTGGGTCCCTGCTTGGGCTCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 447 |
LEAP-Seq percent confirming: | 99.1471 |
LEAP-Seq n confirming: | 465 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACCGTAACCGCCACTGTAAG |
Suggested primer 2: | GTGCTATAGGCGTGATGGGT |