Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.224574 |
Chromosome: | chromosome 14 |
Location: | 3866119 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre14.g632783 | (1 of 1) K06634 - cyclin H (CCNH) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCGCATCCTCCACCCCGTCACGCATGAAT |
Internal bar code: | GCTAGGTTAAGCCACTTTAGTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1091 |
LEAP-Seq percent confirming: | 95.1906 |
LEAP-Seq n confirming: | 3246 |
LEAP-Seq n nonconfirming: | 164 |
LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCATGTTTTGATGTGGATGC |
Suggested primer 2: | CCCTTTCAACTCTCACCTGC |