Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.224590 |
Chromosome: | chromosome 7 |
Location: | 4211353 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g342050 | NPSN1,VTI3 | (1 of 1) K08494 - novel plant SNARE (NSPN); Endosomal Qb-SNARE, Npsn-family (plant/protist-specific) (Qb.III.d) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGCCTGGCGGGAAGGCGGGCTGGGGCTGG |
Internal bar code: | AGTGTCACTCACCACTGACTCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1044 |
LEAP-Seq percent confirming: | 99.5373 |
LEAP-Seq n confirming: | 23666 |
LEAP-Seq n nonconfirming: | 110 |
LEAP-Seq n unique pos: | 30 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTCTGAAGCGGCAAATAAGC |
Suggested primer 2: | GTTCTCGGCTCCACTGACTC |