Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.224664 |
Chromosome: | chromosome 9 |
Location: | 162100 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g386736 | FAP44 | Flagellar Associated Protein 44; (1 of 1) PTHR13720//PTHR13720:SF18 - WD-40 REPEAT PROTEIN // WD REPEAT-CONTAINING PROTEIN 52 | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGCTAGTGAGCCGCTTGTCACCCGCCGCA |
Internal bar code: | GTGCGCGTCGCACCCGGGGTAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 621 |
LEAP-Seq percent confirming: | 98.1469 |
LEAP-Seq n confirming: | 1430 |
LEAP-Seq n nonconfirming: | 27 |
LEAP-Seq n unique pos: | 35 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAGGCTTTGACCCTGTTTCA |
Suggested primer 2: | GACGACATCGTTCAAGCAGA |