Insertion junction: LMJ.RY0402.224664_2

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:-
Strain:LMJ.RY0402.224664
Chromosome:chromosome_9
Location:162106
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre09.g386736 FAP44 Flagellar Associated Protein antisense 5'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):AGATTATATCTGTTCCAGTCTAATGATACC
Internal bar code:GCAAATAGTCCTTTGTGGGTCT

Confirmation - LEAP-Seq

LEAP-Seq distance:806
LEAP-Seq percent confirming:99.3535
LEAP-Seq n confirming:3842
LEAP-Seq n nonconfirming:25
LEAP-Seq n unique pos:7

Suggested primers for confirmation by PCR

Suggested primer 1:AGTAAGACCATCAGCGGCAT
Suggested primer 2:GACGACATCGTTCAAGCAGA