| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.224681 |
| Chromosome: | chromosome 12 |
| Location: | 5698448 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g532600 | CGL44 | RabGAP/TBC Domain Protein; (1 of 14) PF00566 - Rab-GTPase-TBC domain (RabGAP-TBC) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTTCCATGGGTCAGAATTCTTTGCTGAGA |
| Internal bar code: | GGCACGTCCACTGGGTGTGTAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 255 |
| LEAP-Seq percent confirming: | 97.5923 |
| LEAP-Seq n confirming: | 608 |
| LEAP-Seq n nonconfirming: | 15 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGAGAATGCTCGCAGTGTG |
| Suggested primer 2: | CACCGCTACAGGGGATTCTA |