| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.224704 |
| Chromosome: | chromosome 9 |
| Location: | 4244161 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g394473 | LCI9 | Low-CO2-inducible protein; (1 of 5) 3.2.1.3 - Glucan 1,4-alpha-glucosidase / Lysosomal alpha-glucosidase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGATCTGGATCTACAACAAGTCCGAGGGCC |
| Internal bar code: | TATATATCCAGAATCAATTCGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 650 |
| LEAP-Seq percent confirming: | 97.8546 |
| LEAP-Seq n confirming: | 821 |
| LEAP-Seq n nonconfirming: | 18 |
| LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCAACACGAAAAGACAAGA |
| Suggested primer 2: | TGCTGCGTGGTCTTGTACTC |