| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.224753 |
| Chromosome: | chromosome 12 |
| Location: | 5530907 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g531250 | (1 of 1) K00480 - salicylate hydroxylase (E1.14.13.1) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGCTATGTATTTGGCTTTCGGCGGCCTAT |
| Internal bar code: | GGGTTTTCTCCCGGGCGCGAGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 624 |
| LEAP-Seq percent confirming: | 98.5058 |
| LEAP-Seq n confirming: | 2703 |
| LEAP-Seq n nonconfirming: | 41 |
| LEAP-Seq n unique pos: | 28 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGCACGCTTTACATGTGCT |
| Suggested primer 2: | ATATGACCATAGCCACCCCA |