| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.224756 |
| Chromosome: | chromosome 4 |
| Location: | 2277183 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g220300 | (1 of 6) IPR001680//IPR015943//IPR017986//IPR020472 - WD40 repeat // WD40/YVTN repeat-like-containing domain // WD40-repeat-containing domain // G-protein beta WD-40 repeat | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCAAATCCAGCTTCAGATCATACCCCGGTT |
| Internal bar code: | CGAGCTAAGGCCCCTCCACGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 514 |
| LEAP-Seq percent confirming: | 99.2074 |
| LEAP-Seq n confirming: | 751 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACCAAGGTAAACAAGGGGG |
| Suggested primer 2: | CATGTACAAGCAGGTGGGTG |