| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.224926 |
| Chromosome: | chromosome 9 |
| Location: | 4402049 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g395436 | subunit 4 of splicing factor 3b (SF3b); (1 of 1) PTHR24012//PTHR24012:SF370 - FAMILY NOT NAMED // RNA-BINDING PROTEIN 44 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTTACGCCTCCCCCTGCGTCCCGCCTCCC |
| Internal bar code: | TAAGGTCATTCGGCCTCGACTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 216 |
| LEAP-Seq percent confirming: | 90.1099 |
| LEAP-Seq n confirming: | 164 |
| LEAP-Seq n nonconfirming: | 18 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGGGTCTTGTCTCTAGGCG |
| Suggested primer 2: | GATGCAACAGATCACAACGG |